SPR-Pages

pagelogo
back
What happened in this plot...? - SPRpage
back
This forum is intended for questions about kinetics, Surface Plasmon Resonance and the instruments related to these techniques.

What happened in this plot...?

  • Koreanraichu
  • Topic Author
  • New Member
  • New Member
More
9 years 2 months ago #1 by Koreanraichu
What happened in this plot...? was created by Koreanraichu

(linker)


(DNA)

Linker is different sequence, and DNA is same sequence at all of channel.

Linker 1 TTCTTTCTTCTTCCGCTTCC
Linker 2 GAAAGCAACAAGGATAGGGG
Linker 3 TCACCAATCGCACACTACTC

DNA GAGTAGTGTGCGATTGGTGA

Step is PBS-Streptavidin-PBS-Linker-PBS-3X SSC(+0.1% DW)-DNA-3X SSC(+0.1% DW).
Streptavidin curve is perfectly good, but linker and DNA curve is not so good. especially, DNA.

DNA and linker 3 is perfectly bind partner, but in ch1, the plot goes upper during washinã…Ž... is it problwm of dilution? or other things?
Attachments:

Please Log in or Create an account to join the conversation.

  • Arnoud
  • Moderator
  • Moderator
More
9 years 2 months ago #2 by Arnoud
Replied by Arnoud on topic What happened in this plot...?
Dear K.S.

I know this is a late answer, but it is difficult to give you some advice without knowing the instrument you using.
Please inform us the type of instrument you use and explain how it works. For instance, are there 1, 2, or 3 syringe pumps or is the flow by a peristaltic pump? How is the buffer / analyte switching done: is there an injection loop or is it done by injection of the sample in the running buffer (biacore style)? The flow channels, are they in series or in parallel? How is the temperature stabilization done? More information can help us better.

On the other hand, when I look at these figures, it looks like an improvement over the earlier you have posted. Part of the signal increment looks like drift. This means that washing probably will solve this. Make sure you have washed the chip (and flow and injection system) properly before capturing the linker DNA. Then wash the system again thoroughly before injection of the DNA.

Kind regards
Arnoud

Please Log in or Create an account to join the conversation.

  • Koreanraichu
  • Topic Author
  • New Member
  • New Member
More
9 years 2 months ago - 9 years 2 months ago #3 by Koreanraichu
Replied by Koreanraichu on topic What happened in this plot...?
Dear Arnoud.
I use peristatic pump when I inject sample and buffer, in all of channel. and each buffer and sample stored in tube(buffer:50ml falcon tube, sample : 1.5ml ep-tube), and when buffer changes, I mones tube to tube which tube of peristic pump. sample flows 40ul/min.
all of channel flous like =(parellel), they cannot shuffle when flow on chip.

One the other hand, how can reduce drift?
Last edit: 9 years 2 months ago by Koreanraichu.

Please Log in or Create an account to join the conversation.

Moderators: ArnoudArnoud
Powered by Kunena Forum